Descent of Mankind Theory: Disproved by Molecular Biology
by Rich Deem

Introduction

The current theory of human evolution states that modern humans evolved from more primitive A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids. The first A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus that is supposedly the ancestor of modern humans is A genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecus, which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa. A genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecus comprised a diverse group of small-brained A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal species that were confined to the savannas of Africa. This The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus was supposed to have evolved into the The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens).Homo, which has been defined as A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates with a brain capacity over 700 cc, having appeared in the fossil record by about 2.5 million years ago as An extinct species of the genus Homo, which lived approximately 2.5 million to 1.6 million years ago.Homo habilis in eastern Africa. According to theory, An extinct species of the genus Homo, which lived approximately 2.5 million to 1.6 million years ago.Homo habilis evolved into An extinct species of the genus Homo, which appeared approximately 1.8 million years ago.Homo erectus, which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.8 million to 300 thousand years ago. An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis lived between 400 and 28 thousand years ago. Archaic The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens appeared 400 - 150 thousand years ago, and modern The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates. The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet."

The beginning of trouble - lack of genetic diversity among modern humans

As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates. The maximum A calculated proportion of total genetic variability attributable to the genetic differences between populations.Fst value (a measure of variation between population groups) between human races is 0.08 (1, 2). However, among populations of Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.chimpanzees, orangutans, and other An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primate species, A calculated proportion of total genetic variability attributable to the genetic differences between populations.Fst values are commonly more than 0.20. An examination of 62 common An organic compound made of amino acids arranged in a linear chain, joined together by peptide bonds between the carboxyl and amino groups of the adjacent amino acid residues.protein coding genetic Multiple places on a chromosome where specific genes or genetic markers are located, a kind of address for the gene.loci, indicates a Replacement of one nucleotide in a DNA sequence by another nucleotide or replacement of one amino acid in a protein by another amino acid.substitution rate of 0.011/The place on a chromosome where a specific gene is located, a kind of address for the gene.locus (A member of the racial classification of humanity composed of peoples native to Europe, North Africa, Southwest Asia and parts of South Asia.Caucasoids versus Members of the racial classification of humanity composed of peoples native to North Asia, East Asia, Pacific Oceania, the Americas and Greenland.Mongoloids), to a maximum of 0.029 (Members of the racial classification of humanity composed of peoples native to North Asia, East Asia, Pacific Oceania, the Americas and Greenland.Mongoloids versus Members of the racial classification of humanity composed of peoples native to sub-Saharan Africa.Negroids). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (2). In humans, Possessing two different forms (alleles) of a particular gene, one inherited from each parent.heterozygosity (the proportion of Variant forms of a gene at a particular locus, or location, on a chromosome.alleles that are Consisting of a common variation in the sequence of DNA among individuals of a species or race.polymorphic, in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the An arboreal great ape belonging to the genus Pongo, consisting of two species, Pongo pygmaeus of Borneo and Pongo abelii, characterized by a reddish-brown coat, very long arms, and no tail.Orangutan to 3.9 in the Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.Chimpanzee (3). An analysis of the genetics of populations of apes reveals that different population groups possess fixed novel Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations that characterize each population. In contrast, there are no novel Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations or genetic Variant forms of a gene at a particular locus, or location, on a chromosome.alleles that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (4). Examinations of the genetic The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of diverse modern human populations reveals minor, if any differences (5). All of this evidence suggested a recent origin for modern humans.

Still more trouble - Discontinuous morphological changes in the A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid lineage

brain capacity Relating to the earth science study of fossil organisms and their related remains.Paleontological discoveries and The science of determining the absolute age of rocks, fossils, and sediments.geochronology show that the pattern of morphological change in the A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid fossil record was not progressive, but abrupt (6). Some adaptations essential to The ability of a species to utilize a form of walking characterized by an erect stance in which the rear legs are used for movement.bipedalism appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" (A species of extinct hominid, living 3.9-2.9 million years ago, made famous by the skeleton "Lucy."Australopithecus aferensis), was said to be A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal, her 2.6 million year old descendent, A species of extinct hominid, living 3-2 million years ago, made famous by the skeletons "Taung Child" and "Mrs. Ples."Australopithecus africanus, was indisputably Living in or spending the majority of its' time in trees.arboreal (7). Primitive Comprising the cranium (braincase) and the teeth.craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of A family of the primate order, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.Hominidae (8). Relative brain size increased slightly among successively younger species of Referring to members of a genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecines, although many Referring to members of a genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecine skulls have brain capacities no larger than those of Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.chimpanzees. (9, 10). However, brain capacities expanded abruptly with the appearance of A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens).Homo, but within early A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens).Homo remained at about half the size of The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes.

Another problem - too many Having a harmful of bad effect.deleterious Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations

A recent study examined the A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate for humans. Using "conservative assumptions" the authors found that the overall A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rates was 4.2 Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations per person per generation, with a Having a harmful of bad effect.deleterious rate of 1.6 (11). When using more realistic assumptions the overall A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate for humans become 6.7 with a Having a harmful of bad effect.deleterious rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion:

"The Having a harmful of bad effect.deleterious A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if Relating to a permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutational effects on fitness were to combine in a multiplicative way."

The authors had to rely upon a rare association of Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations, termed synergistic The interaction between genes, in which the action of one gene is modified by one or several other genes, which are called modifier genes. The gene whose phenotype is expressed is said to be epistatic, while the phenotype altered or suppressed is said to be hypostatic.epistasis to explain why the numerous hypothesized Having a harmful of bad effect.deleterious Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations have not overwhelmed our All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome. Instead of postulating the obvious (that the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome is not as old as evolution would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm.

Recent origin of modern humans confirmed through The branch of science that studies the structure and activity of macromolecules essential to life (and especially related to their genetic role).molecular biology


Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA (Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA)

In the late 1980's and early 1990's a number of studies were done examining the Of or referring to the mitochondria, the organelles that generate energy for the cell.mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA ( Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (15) and finally 100,000 years (16). Scientists chose to examine Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA because, being enclosed within the subcellular organelle called the The organelle that generates energy for the cell.mitochondrion, there is no genetic recombination (males make no contribution of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA to the fetus). All Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA comes from our mothers and is passed down from mother to daughter, since only The organelles that generate energy for the cell.mitochondria from the egg are used to make up the fetus. By tracing the differences in Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago.

One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y-chromosome analysis

In 1995, scientists have examined human origins from the perspective of male genetics (17, 18). Scientists have examined a gene (ZFY), which being on the One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence in each man for this gene, which is 729 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs long. To their surprise, all men had identical genetic The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences (over 27,000 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (19). The other study used a very large piece of the One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome (18,300 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (16). This latter study also examined Of or referring to the mitochondria, the organelles that generate energy for the cell.mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA from women and determined an origination date of 90,000-120,000 years ago.

The non-random association of alleles at two or more genetic loci, in which combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.Linkage disequilibrium analysis

A study published in 1996 (20) examined The association of genes and/or markers that lie near each other on a chromosome that tend to be inherited together.linkage The non-random association of alleles at two or more genetic loci, in which combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.disequilibrium at the human CD4 The place on a chromosome where a specific gene is located, a kind of address for the gene.locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the A family of approximately 300 bp repetitive sequences, found dispersed throughout the human genome.Alu (-) Variant forms of a gene at a particular locus, or location, on a chromosome.alleles arose 5 million years ago, or almost immediately after mankind's split from other An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates. As they stated, "It is likely that the A family of approximately 300 bp repetitive sequences, found dispersed throughout the human genome.Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from Threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosomes 19, 11 and 8 show similar results to that seen on One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosome 12 (the The place on a chromosome where a specific gene is located, a kind of address for the gene.locus of the CD4 gene) (21).

Using rare mutations to estimate population divergence times

A study published in 1998 examined population divergence time using rare Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations between populations to estimate divergence among three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans.

The nail in the coffin

Therefore, the most accurate date (see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (16). Such a recent date left only one potential ancestor for modern humans, that is, An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis (An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals being the ancestors of modern humans (23-27). These studies showed differences in Belonging to an extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal's brain case (23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an Being made of bone or referring to the calcification of tissue into bone.ossified roof over the Relating to or located near the organ that produces tears.lacrimal groove (24-25). None of these features are found in The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens, and the last feature is not found in any other terrestrial mammal! A recent analysis of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal hands has revealed that modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals differed markedly in the kind of grip they could use (26). An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal), but not very dexterous. The anatomy of the Belonging to an extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal's hands would have prevented them from engaging in fine motor skills, such as carving and painting. Another study showed that An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals developed much more rapidly than modern humans (or even their own supposed ancestors) (27), further eroding their possible status as mankind's ancestors. In addition, An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals had a huge nasal cavity coupled with a brain size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids (28).

In brilliantly designed and executed independent studies, scientists have extracted Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA from four An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal skeletons; two from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the fourth in Vindija Cave, Croatia, and laid to rest any question of whether An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals could have been our ancestors (29-32). The first study examined a 379 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA fragment and compared it with a Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of 986 One of the structural components, or building blocks, of DNA and RNA. A nucleotide consists of a base plus a molecule of sugar and one of phosphate.nucleotide pairs from living humans of diverse ethnic backgrounds. The results (Table 1) showed an enormous 26 One of the structural components, or building blocks, of DNA and RNA. A nucleotide consists of a base plus a molecule of sugar and one of phosphate.nucleotide Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair difference between the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal and Human Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA (a 6.5% difference) (29). In this region of the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA, modern humans differ from one another in an average of eight Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs, and those differences were completely independent of the 26 observed for the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal fossil. However, many of the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence variations found in the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were shared in the Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.Chimpanzee. A 357 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA was examined from the second An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal fossil and was found to vary from modern human The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences at 23 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases (6.4%), nineteen of which were identical to those of the first An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal. The third An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal differed from modern humans by 26 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases, 23 of which matched the first An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal and 20 of which matched the second specimen. The fourth An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal differed from modern humans by 23 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases, 22 of which matched the first An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal, 20 of which matched the second specimen and 23 of which matched the third specimen. A summary of the findings of the two studies can be found in Table 1, below.

Table 1. The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Differences* Between Modern Humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals
Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sample
(Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1)
Sequence Number (Read Down)
111111111111111111111111111111111
666666666666666666666666666666666
000011111111111112222222222233334
378900112345568880233455667912571
786378129984692399304468238910420
Modern Human AATTCCCCGACTGCAATTCACGCAC-CATCCTC
Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.Chimpanzee ......T.ATT.....ACTGAAA....G....
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #1 GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #2  .C.....ATT.ATCCCCTGTAA.TATGCTTC
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #3 GG......ATTC.TCCCCTGTAAGTATGCT.C
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #4 GG......ATTC.TCCCCTGTAA.TATGCT.C
* Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1

The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal disappeared (33). If An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Belonging to an extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal's genetics. In addition, since the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal fossils were separated geographically by over 2,500 km, it shows that An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were a homogeneous species. The researchers conclusion: "An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study).

Although the differences between modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals are large, the differences among individual humans or among individual An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals is small compared to other apes (Table 2). Such low genetic diversity among An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals are consistent with a creation model in which An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans.

Table 2. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation (%) Within Species (31)
Population Individuals Mean Minimum Maximum s.d.
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals 0,003 03.73 - - -
Humans 5,530 03.43 0.00 10.16 1.21
Chimpanzees  0,359 14.81 0.00 29.06 5.70
Gorillas 0,028 18.57 0.40 28.79 5.26

The final blow to the idea that humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals interbred was found in a genetic analysis of their Relating to one of the threadlike 'packages' of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosomal Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA, published in 2006-2007 (34). These results showed that none of the typical SNPs found in modern humans was present in An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y-chromosome Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA.

Ancient Anatomically Modern Humans - the missing evidence

Knowing the variation of The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences between modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals is important in determining if An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of 10 ancient Australians (35). A summary of the Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of these individuals (compared with the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, modern Aboriginal A common variation in the sequence of DNA among individuals of a species or race.polymorphism, An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals, and Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.chimpanzees) can be found in Table 3, below. The first thing that one notices is that the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence variation of ancient humans compared to modern humans is at most 10 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs. LM3, dated at 40,000 years old (redated from the original estimate of 62,000 years old, 36), varied the most from the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, but this variation included only three Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases shared with An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced to date), it is apparent that the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome was already nearly "modern" before An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals died out. The authors of the study made a big deal about the LM3 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence sharing similarity to a portion of One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosome 11 in modern humans (thought to have been inserted into the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome from the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA). The authors concluded that the "loss" of the ancient Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA variation seen in LM3 could explain how An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals do not share Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA with modern humans. Although it is certainly possible that part of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA might find its way into the nuclear All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome, it doesn't address the issue of how the variation seen in the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA of LM3 was "lost." In fact, of the ten The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences between LM3 and the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, five of those Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases correspond to A common variation in the sequence of DNA among individuals of a species or race.polymorphisms found in modern Aboriginal people, showing that those five Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases were not lost at all. This leaves only a five Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 40,000 years stands in sharp contrast to the large differences seen between modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals. European evolutionists have also disputed the claims of Adcock et al. in the journal Science in June, 2001. More information on this can be found in the paper, New DNA Evidence Supports Multiregional Evolutionary Model?

A second study examined the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of two Cro-Magnon specimens dated to 23,000 and 25,000 years old (37). One specimen (Paglicci-25) had no The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences from the modern reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, and the other (Paglicci-12) only one Replacement of one nucleotide in a DNA sequence by another nucleotide or replacement of one amino acid in a protein by another amino acid.substitution (see Table 3). It is remarkable that so little change in the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence had occurred over the last 23,000 years.

Table 3. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation of Ancient, Anatomically Modern Humans (33)
Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sample
(Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1)
Age
(ka)
Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817
Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
The common name for Pan paniscust, also known as the Pygmy Chimpanzee.Bonobo 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal #1 40 GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM3 40# ....................T.G...........CT.T....T..T......TC....G
Paglicci-25 23 ...........................................................
Paglicci-12 25 ....................T......................................
* Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1
#redated from the original 62 ka estimate.

The ancient Cro-Magnon Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA and modern European Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA differed by only 2-3 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs (see Table 4). This difference is even less than that observed among modern Europeans! In contrast, these ancient modern humans differed from nearly contemporary An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals by an average of 24 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs.

Table 4. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation Among Modern and Ancient Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.Hominids (37)
Individual Modern Europeans An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals
Mean Min. Max. s.d. Mean Min. Max. s.d.
Paglicci-25 2.3 0 11 1.8 24.5 23 28 2.4
Paglicci-12 3.2 0 10 1.7 23.5 22 27 2.4
Modern Europeans 4.4 0 18 2.3 - - - -

According to the authors of the study:

"Although only six Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of ancient a.m.h [anatomically modern humans] and four The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals are available to date, the sharp differentiation among them represents a problem for any model regarding the transition from archaic to modern humans as a process taking place within a single evolving human lineage." (37)

Conclusion Top of page

There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the An evolutionary theory that proposes that modern humans arose at multiple regions around the world and interbred to produce the modern human species.multiregional model, which states that modern humans evolved simultaneously on different continents. The branch of science that studies the structure and activity of macromolecules essential to life (and especially related to their genetic role).Molecular biology destroys the An evolutionary theory that proposes that modern humans arose at multiple regions around the world and interbred to produce the modern human species.multiregional model (12-22, 29-37). In addition, even the fossil evidence does not support the An evolutionary theory that proposes that modern humans arose at multiple regions around the world and interbred to produce the modern human species.multiregional model (38). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern The branch of science that studies the structure and activity of macromolecules essential to life (and especially related to their genetic role).molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (12-22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (39) and evidence of religious expression appears only 25,000-50,000 years ago (40, 41). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35,000 to 45,000 years ago) in Europe include (42):

Simultaneous, rapid changes in human abilities suggest replacement of previously existing Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids could be our ancestors, since An extinct species of the genus Homo, which appeared approximately 1.8 million years ago.Homo erectus died out 300,000 years ago, and An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis has been proven to be too genetically different from us to have been our ancestor (29, 30). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out Genesis 1:26 (43).



Who Was Adam?: A Creation Model Approach to the Origin of ManWho Was Adam?: A Creation Model Approach to the Origin of Man. Are humans just advanced apes or have they been specially created in the image of God? Publications by scientists almost never ask the question, whereas publications by theists seldom examine the scientific data that relates to the question. However, two scientists raised in non-Christian homes, Fuz Rana (Ph.D. in chemistry) and Hugh Ross (Ph.D. in astronomy), have written a new book (Who Was Adam?: A Creation Model Approach to the Origin of Man) that examines the question of human origins by comparing biblical and evolutionary models.


References Top of page

  1. R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398
  2. M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59
  3. Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of An arboreal great ape belonging to the genus Pongo, consisting of two species, Pongo pygmaeus of Borneo and Pongo abelii, characterized by a reddish-brown coat, very long arms, and no tail.orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387
  4. Gibbons, A. 1995. The mystery of humanity's missing Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations. Science 267: 35-36.
  5. Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840
  6. Wood B. 1992. Origin and evolution of the The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens).Homo. Nature 355: 783-790.
  7. Shreeve, J. 1996. New skeleton gives path from trees to ground an odd turn. Science 272: 654
  8. McHenry H.M. 1994. Body size and proportions in early Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids. Proceedings of the National Academy of Sciences of the United States of America 91: 6780-6786.
  9. Dean Falk. 1998. A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.Hominid brain evolution: looks can be deceiving. Science 280: 1714
  10. Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden. 1998. Endocranial capacity in an early A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid cranium from Sterkfontein, South Africa. Science 280: 1730-1731.
  11. Eyre-Walker, A. & Keightley, P. D. 1999. High genomic Having a harmful of bad effect.deleterious A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rates in Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids. Nature 397, 344-347.
  12. R.L. Cann, M. Stoneking, A.C. Wilson. 1987. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA and human evolution. Nature 325: 31.
  13. L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson. 1991. African populations and the evolution of human Of or referring to the mitochondria, the organelles that generate energy for the cell.mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA. Science 253: 1503.
  14. M. Hasegawa, S. Horai. 1991. Time of the deepest root for A common variation in the sequence of DNA among individuals of a species or race.polymorphism in human Of or referring to the mitochondria, the organelles that generate energy for the cell.mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA. J. Mol. Evol. 32: 37.
  15. Stoneking M, Sherry ST, Redd AJ, Vigilant L. 1992. New approaches to dating suggest a recent age for the human Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: 167-175.
  16. Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence variation of the human One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome. Nature 378: 379-380.
  17. S. Paabo. 1995. The One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome and the origin of all of us (men). Science 268: 1141.
  18. R.L. Dorit, H. Akashi, W. Gilbert. 1995. Absence of A common variation in the sequence of DNA among individuals of a species or race.polymorphism at the ZFY The place on a chromosome where a specific gene is located, a kind of address for the gene.locus on the human One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome. Science 268: 1183.
  19. Hammer, M.F. 1995. A recent common ancestry for human One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y Chromosomes. Nature 378: 376-378.
  20. Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd. 1996. Global patterns of The association of genes and/or markers that lie near each other on a chromosome that tend to be inherited together.linkage The non-random association of alleles at two or more genetic loci, in which combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.disequilibrium at the CD4 The place on a chromosome where a specific gene is located, a kind of address for the gene.locus and modern human origins. Science 271: 1380-1387.
  21. Fischman, J. 1996. Evidence mounts for our African origins - and alternatives. Science 271: 1364.
  22. G. and B. Rannala. 1998. Using rare Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations to estimate population divergence times: A maximum likelihood approach. Proceedings of the National Academy of Science USA 95: 15452-15457.
  23. Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle The epoch from 1.8 million to 10,000 years year ago, covering the world's recent period of repeated glaciations.Pleistocene A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid evolution. J. Hum. Evol. 33:691-703.
  24. Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis. Proceedings of the National Academy of Science USA 93: 10852-10854.
  25. Laitman, J.T., J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545.
  26. Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature.
    Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences.
  27. Ramirez, F. V., R. and J. Maria Bermudez de Castro. 2004. Surprisingly rapid growth in An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals. Nature 428: 936-939 doi:10.1038/nature02428.
  28. Holden, C. 1999. A New Look Into An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals' Noses. Science 285: 31-33.
  29. Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA Sequences and the Origin of Modern Humans. Cell 90: 19-30.
  30. Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA from the northern Caucasus. Nature 404: 490-493.
  31. Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. P��bo. 2000. A view of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal genetic diversity Nature Genetics 26: 144-146.
  32. Schmitz, R. W., Serre, D., Bonani, G., Feine, S., Hillgruber, F., Krainitzki, H., P��bo, S. & Smith, F. H. 2002. The An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal type site revisited: Interdisciplinary investigations of skeletal remains from the Neander Valley, Germany. Proceedings of the National Academy of Science USA 99: 13342-13347
  33. Stringer, C. B. and R. Mackie. 1996. African Exodus: the Origin of Modern Humanity. Cape, London.
  34. Pennisi, E. 2007. ANCIENT Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA: No Sex Please, We're An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals. Science 316: 967.
  35. Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542
  36. Bowler, J. M., Johnston, H., Olley, J. M., Prescott, J. R., Roberts, R. G., Shawcross, W., and Spooner, N. A. 2003. New ages for human occupation and climatic change at Lake Mungo, Australia. Nature 421: 837-840.
  37. Caramelli, D., C. Lalueza-Fox, C. Vernesi, M. Lari, A. Casoli, F. Mallegnii, B. Chiarelli, I. Dupanloup, J. Bertranpetit, G. Barbujani, and G. Bertorelle. 2003. Evidence for a genetic discontinuity between An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals and 24,000-year-old anatomically modern Europeans. Proceedings of the National Academy of Science USA 100: 6593-6597.
  38. Foley R. 1998. The context of human genetic evolution. Genome Res 8:339-347.
  39. Klein, R.G. 1992. Evolutionary Anthropology 1: 5-14.
    Balter, M. 1999. Restorers reveal 28,000-year-old artworks. Science 283: 1835.
  40. Simon, C. 1981. Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357.
  41. Bower, B. 1986. When the human spirit soared. Science News 130: 378-379.
  42. Clark, G.A. 1999. Highly visible, curiously intangible. Science 283: 2029-2032.
  43. Then God said, "Let Us make man in Our image, according to Our likeness; and let them rule over the fish of the sea and over the birds of the sky and over the cattle and over all the earth, and over every creeping thing that creeps on the earth." (Genesis 1:26)

Note:
The 50,000 year date is the best estimate for modern human origins because the study used a much larger One of the structural components, or building blocks, of DNA and RNA. A nucleotide consists of a base plus a molecule of sugar and one of phosphate.nucleotide Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair sample size, resulting in a much less uncertainty in the date generated (see the table below for further explanation).

95% confidence interval
Study Model # Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs # men Total Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs Lower Upper Mean Male population size
Dorit, et al. Relating to the mathematical and statistical properties of genealogies. A modelling framework in which two DNA sequence lineages converge in a common ancestral sequence, going backwards in time.Coalescent 729 38 27702 0 800,000 270,000 7,500
Dorit, et al. A mathematical and statistical model in which each individual is derived independently from the original ancestor.Star phylogeny 729 38 27702 0 80,000 27,000 7,500
Hammer Relating to the mathematical and statistical properties of genealogies. A modelling framework in which two DNA sequence lineages converge in a common ancestral sequence, going backwards in time.Coalescent 2,600 15 39,000 51,000 411,000 188,000 5,000
Whitfield, et al. Relating to the mathematical and statistical properties of genealogies. A modelling framework in which two DNA sequence lineages converge in a common ancestral sequence, going backwards in time.Coalescent 18,300 5 91,500 37,000 49,000 43,000 not given

The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the The amount of time elapsed between the introduction of a mutation and a particular allele or gene distribution in a population, which is equal to the length of time the most recent common ancestor has existed.coalescence time as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the The amount of time elapsed between the introduction of a mutation and a particular allele or gene distribution in a population, which is equal to the length of time the most recent common ancestor has existed.coalescence time was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large A measure of the precision of estimated values, representing the range of possible values, believed to encompass the "true" values with high probability (usually 95%).confidence intervals, due to the small number of One of the structural components, or building blocks, of DNA and RNA. A nucleotide consists of a base plus a molecule of sugar and one of phosphate.nucleotide Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs analyzed. Given the size of the A measure of the precision of estimated values, representing the range of possible values, believed to encompass the "true" values with high probability (usually 95%).confidence intervals in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans.

http://www.godandscience.org/evolution/descent.html
Last Modified February 15, 2008

 

Rich's Blog